Parsing Text Files and Spliting on '>'

[meixiang6]

Hi can some kind person help with this JAVA Q on parsing text files: INPUT TEXT (FASTA) FILE: >AB485992 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT >AB485993 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT >AB485994 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT >AB485922 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT >AB485912 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT >AB485942 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT I need JAVA Code that parses the input file and generates 6 files each file contains file is labelled after the '>' and before the space ie file 1 will be named AB485992 and that file will contain the text between the '>' and the following '>' ie: >AB485992 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT file 2 will be labelled: AB485993 and it contents >AB485993 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT file 3 will be labelled: AB485993 and it contents >AB485994 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT and so on for all six files So far I have code that parses out the word after '>' ie the file label and prints those to args file like below, can some kind person PLEASE show me how to parse the INPUT file and generate the 6 seperate files as described above each file labeled after the '>' eg file1, labelled AB485992 and so on for the 6 files >AB485992 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT THANKS SO MUCH! import java.io.*; import java.util.Scanner; public final class ReadWithScanner { public static void main(String... aArgs) throws FileNotFoundException { File f = new File("args"); f.delete(); ReadWithScanner parser = new ReadWithScanner("file.text"); parser.processLineByLine(); log("Done."); } public ReadWithScanner(String aFileName){ fFile = new File(aFileName); } public final void processLineByLine() throws FileNotFoundException { Scanner scanner = new Scanner(fFile); try { while ( scanner.hasNextLine() ){ processLine( scanner.nextLine() ); } } finally { scanner.clo

[4277480]

I took it one step further.

import java.io.*;
import java.util.*;

public class SplitFiles {
public static void main(String[] args) throws Exception {
File mainfile = new File("MainFile.txt");

	Scanner scan = new Scanner(mainfile);

	ArrayList<String> List = new ArrayList<String>();

	String getFileName = "";

	while (scan.hasNext()) {
		List.add(scan.nextLine());
	}

	for (int i = 0; i < List.size(); i++) {
		if (List.get(i).charAt(0) == '>') {

			getFileName = List.get(i).replace(">", "");

			String result = "";

			for (int j = 0; j < getFileName.length(); j++) {
				if (getFileName.charAt(j) == ' ') {
					result = getFileName.substring(0, j);
					break;
				}
			}

			File output;

			if (new File(result + ".txt").exists()) {
				BufferedWriter out = new BufferedWriter(new FileWriter(
						result + ".txt", true));

				out.write(List.get(i) + "\\n");

				int k;

				for (k = i + 1; k < List.size(); k++) {
					if (List.get(k).charAt(0) == '>')
						break;
					else {
						out.write(List.get(k) + "\\n");
					}
				}

				out.close();
			} else {
				output = new File(result + ".txt");

				PrintWriter out = new PrintWriter(output);

				out.println(List.get(i));

				int k;

				for (k = i + 1; k < List.size(); k++) {
					if (List.get(k).charAt(0) == '>')
						break;
					else {
						out.println(List.get(k));
					}
				}

				out.close();
			}
		}
	}
}

}

Good Luck

[meixiang6]

Thanks so much for your help! Just one small point the code you wrote here "for (k = i+1; k " is missing the end part any chances you know what the ending should be? Thanks again!

[4277480]

Yes that happens with < > in code, I corrected it.

[meixiang6]

Thanks so much! I tried compiling and I am getting complaints as follows, any ideas? Sorry I am new to JAVA and cant figure out how to fix it. thanks again! SplitFiles.java:24: cannot find symbol symbol : method charAt(int) location: class java.lang.Object if (List.get(i).charAt(0) == '>') ^ SplitFiles.java:27: cannot find symbol symbol : method replace(java.lang.String,java.lang.String) location: class java.lang.Object getFileName = List.get(i).replace(">", ""); ^ SplitFiles.java:52: cannot find symbol symbol : method charAt(int) location: class java.lang.Object if (List.get(k).charAt(0) == '>') ^ SplitFiles.java:74: cannot find symbol symbol : method charAt(int) location: class java.lang.Object if (List.get(k).charAt(0) == '>')

[4277480]

Steps: 1. Copy the code into your Java project. 2. Create a Text file called MainFile.txt containing what you wanted in the first post. It should work since I corrected the < and > (HTML problem) in my answer post.

[meixiang6]

It works, thank you so much!