Hi cechode; The code snippet below will generate a sequence of integers that start at 5 and adds 12 to each previous value and will end with a value of 100 or less.

IEnumerable<int> index = Enumerable.Range(5, 100).Where(idx => (idx % 7) == 5 && idx <= 100);

Fernando

Hi Stryder_1; Are you saying that doing this code still gives you a time out exception? DataClasses1DataContext db = new DataClasses1DataContext(); var con = db.Connection; con.Open(); // Do both your Linq queries here con.Close(); My dilemma is that if you are still getting a time out exception while the connection is open then I don't know what is going on then because the two executions are happening on the same connection, the second execution does not need to open the connection because it is already open. Fernando

To your statement. "I don't want to put a pause there because I want to be sure the first has completed before continuing, not just guess that is is finished.", The ExecuteQuery method does not continue to the next exectueable statement in your code until it has received the results from that call. Most likely the problem is that the connection is timing out. You have two options you can take, 1 increase the timeout from the default of 30 seconds. or 2 open the connection yourself before the first call to ExecuteQuery and closing it just after the second call to ExecuteQuery. To increase the timeout you can do this just after creating a DataContext: DataContext.CommandTimeout = 40; Or Opening the connection : DataClasses1DataContext db = new DataClasses1DataContext(); var con = db.Connection; con.Open(); // Do your Linq queries here con.Close(); Fernando

Hi Collin; This can be done with linq as shown in the code snippet below.

// Your values from Index property
List<int> myElements = new List<int>() { 8, 5, 9, 3, 4 };

// Create all integers from min value to max value in above collection
var range = from n in Enumerable.Range(myElements.Min(), myElements.Max() - myElements.Min() + 1)
select n;

// Find all missing values
List<int> result = range.Except(myElements).ToList();

Let say that the instantiated data context is db, then you query in Linq would be as follows :

var r2 = from rtgr in db.mmlaspnet_RolesToGlobalRoles
select rtgr.RoleId;
var r1 = from r in db.aspnet_Roles
where r2.Contains(r.RoleId)
orderby r.RoleName
select r;

fereach( var roles in r1 )
{
Console.WriteLine("RoleID = {0} ....", role.RoleId, ...);
}

What is the source of the data to fill the DataTable and is the DataTable already instantiated?

It is not possible to define 2 DataContext and create a query that uses tables from both of them.

Hi Amer Rehman; If you are using .Net Framework 2.0 or higher you can use the Control.ControlCollection.Find Method to find a control. The second parameter states to search all child controls as well as shown in the code snippet below.

Private Function CheckControl(ByVal ctrlName As String) As Boolean

Dim blnResult As Boolean = False

If (Me.Controls.Find(ctrlName, True).Length > 0) Then
    blnResult = True
End If

Return blnResult

End Function

Fernando

Hi Roland; The short answer is you cannot. The ConsoleColor is an enumeration which cannot be modified. Here is the link to the documentation of ConsoleColor: http://msdn.microsoft.com/en-us/library/system.consolecolor.aspx[^]

The DataBind is a method call and the syntax should be: this.GridView2.DataBind();

Hi poojapande; You can use the ToCharArray method of the string class as shown in the code snippet.

Dim geneSeq As String = "ATTATCGATGATATTATTGGTCTTATTTGT"
Dim splitseq() As Char

splitseq = geneSeq.ToCharArray()

' Display the splitseq array
For Each ch As Char In splitseq
Console.WriteLine(ch)
Next

Fernando

Option 2 is the way to go. No need to tie up system resources when it is not being used.

It is the only way to get a flatten result set.

Hi ywang555; In the select statement explicitly select each field of c and cv. For example: Select New With {c.Field1, c.Field2, ... , c.Fieldn, cv.CoverageCode} Fernando

Hi dec82; you could use a regular expression to pull the numeric data out.

    ' Test data
    Dim testData As String = "abcd 36.2"
    ' String to hold the wanted info
    Dim numericValue As String = String.Empty
    ' A regular Expression to pull out the needed info
    Dim m As Match = Regex.Match(testData, "^.\*?(\\d+(?:\\.\\d+)?)")
    ' Test to see if the string had a numeric value on the end of it
    If m.Success Then
        ' Pull out the information
        numericValue = m.Groups(1).Value
    End If

    MessageBox.Show("Numeric Value = " & numericValue)

Fernando

Not a problem, glad to help.

Hi Mohammad; This should do what you want.

XElement xElement = XElement.Parse(xmlSTR);
var max = (from q in xElement.Descendants("Part")
let val = Convert.ToInt32(q.Attribute("ID").Value)
orderby val descending
select q).First();

MessageBox.Show(max.ToString());

Fernando

Not a problem, glad I was able to help. :thumbsup:

Hi Howard; This should do what you want.

XElement xElement = XElement.Parse(xmlSTR);
var max = (from q in xElement.Descendants("Part")
let val = Convert.ToInt32(q.Attribute("ID").Value)
orderby val descending
select q).First();

MessageBox.Show(max.ToString());

Fernando

Hi Muhammad; This will display the date only

' Simulate date and time from the DB
Dim dt As DateTime = Now

' This will display the date only
MessageBox.Show(dt.ToString("MM/dd/yyyy"))

Fernando