It works, thank you so much!

Thanks so much! I tried compiling and I am getting complaints as follows, any ideas? Sorry I am new to JAVA and cant figure out how to fix it. thanks again! SplitFiles.java:24: cannot find symbol symbol : method charAt(int) location: class java.lang.Object if (List.get(i).charAt(0) == '>') ^ SplitFiles.java:27: cannot find symbol symbol : method replace(java.lang.String,java.lang.String) location: class java.lang.Object getFileName = List.get(i).replace(">", ""); ^ SplitFiles.java:52: cannot find symbol symbol : method charAt(int) location: class java.lang.Object if (List.get(k).charAt(0) == '>') ^ SplitFiles.java:74: cannot find symbol symbol : method charAt(int) location: class java.lang.Object if (List.get(k).charAt(0) == '>')

Thanks so much for your help! Just one small point the code you wrote here "for (k = i+1; k " is missing the end part any chances you know what the ending should be? Thanks again!

Hi can some kind person help with this JAVA Q on parsing text files: INPUT TEXT (FASTA) FILE: >AB485992 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT >AB485993 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT >AB485994 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT >AB485922 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT >AB485912 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT >AB485942 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT I need JAVA Code that parses the input file and generates 6 files each file contains file is labelled after the '>' and before the space ie file 1 will be named AB485992 and that file will contain the text between the '>' and the following '>' ie: >AB485992 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT file 2 will be labelled: AB485993 and it contents >AB485993 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT file 3 will be labelled: AB485993 and it contents >AB485994 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT and so on for all six files So far I have code that parses out the word after '>' ie the file label and prints those to args file like below, can some kind person PLEASE show me how to parse the INPUT file and generate the 6 seperate files as described above each file labeled after the '>' eg file1, labelled AB485992 and so on for the 6 files >AB485992 some text ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT ATTGGGAATGGAGGGAAATAAATGACTGGATGGTCGCTGCT THANKS SO MUCH! import java.io.*; import java.util.Scanner; public final class ReadWithScanner { public static void main(String... aArgs) throws FileNotFoundException { File f = new File("args"); f.delete(); ReadWithScanner parser = new ReadWithScanner("file.text"); parser.processLineByLine(); log("Done."); } public ReadWithScanner(String aFileName){ fFile = new File(aFileName); } public final void processLineByLine() throws FileNotFoundException { Scanner scanner = new Scanner(fFile); try { while ( scanner.hasNextLine() ){ processLine( scanner.nextLine() ); } } finally { scanner.clo

Thanks stuart, it works nicely.

I want to use vectors in C++ on a linux box to parse a tab delimited text file and parse something in the second column. In perl I could do something like this: In perl: #!/usr/local/bin/perl while(<>) { chomp; ($first_col, $second_col, $third_col)=split(/\t/,$_); if ($second_col =~ m/$target/g){ print "$second_col\n"; } } In C++ I have the following 2 D code, can someone modify it to parse out text in the column 2 using vectors? Thanks for everyones help in advance.... #include #include #include #include #include using namespace std; int main() { ifstream ff( "test.txt", ios::in ); if ( !ff.is_open() ) return -1; string name; vector names; while( !ff.eof() ) { ff >> name; if (!ff.eof()) names.push_back( name ); } copy (names.begin(), names.end(), ostream_iterator(cout,"\n")); return 0; }

I will give it a try tommorrow...thanks!

Thanks Stuart, very useful..

Thank you so much grzkas!:thumbsup:

After a lot of wrong examples from googling the web, I finally find something that works: myFileName = file; inp.open(myFileName.c_str(), ifstream::in); inp.close(); if(inp.fail()) { inp.clear(ios::failbit); cout << "No File found " << myFileName.c_str() << endl; exit(5); } else { cout << "Found File" << myFileName.c_str() << endl; } Thanks, hope this might help someone else... Bye the way is this board only for Visual C++ or can someone working on Linux with C++ ask Qs?

PathFileExists is a windows API and I am running C++ in linux so it doesnt work as far as I know and have been trying unless I goofed up...

#include #include #include #include #include // getcwd() definition #include // MAXPATHLEN definition using namespace std; int main() { string database; cout << "Select full path of Database" << endl; cin >> database; How do I check the existence of a file in C++? In perl it would be something like: if (!database){ print "No database found\n"; exit; } I tried looking online for hours but all the suggestions didnt work so far.. Thanks in advance!

Following to my question yesterday, is there anything that can be done to clean up the c code below which works fine but looks ugly especially the strcat's? The program parses a file containing a list of files and then runs a command on each. I can do a similar thing in perl like this a couple of lines but in C its looks ugly and I think its because I am a newbie...any comments will be appreciated.... thanks in advance for everyones help In perl: #!/usr/bin/perl while(<>){ chomp; $cmd="qsub -P 9999 -wd -e $_\.error -b y /usr/local/projects/bin/program -i $_ -type p -terms -lookup -o $_\.qsub"; print "$cmd\n"; } in C: #include #include #include #include #include #include int main(int argc, char *argv[]) { char * cwd = getcwd(0,0); char pro[10000]; char str[1000]; char* nl; if (argc < 3) { printf("\n\nPlease supply a file containing a list of single file names follow by project code\n"); exit(5); } FILE *f; f = fopen(argv[1], "r"); if(!f) { printf("Couldn't open file.txtn"); return 1; } while(fgets(str, 1000, f)) { nl = strrchr(str, '\r'); if (nl) *nl = '\0'; nl = strrchr(str, '\n'); if (nl) *nl = '\0'; strcpy(pro, "qsub -P "); strcat(pro, argv[2]); strcat(pro, " -wd -e "); strcat(pro, cwd); strcat(pro, "/"); strcat(pro, str); strcat(pro, ".error -b y /usr/local/projects/bin/program -i "); strcat(pro, cwd); strcat(pro, "/"); strcat(pro, str); strcat(pro, " -type p -terms -lookup -o "); strcat(pro, str); strcat(pro, ".qsub"); printf (pro); system(pro); } }

Thanks Stuart, I got it working with this, not sure if the code is right thou but it works... #include #include int main() { FILE *f; char string[1000]; char str[1000]; f = fopen("file.txt", "r"); if(!f) { printf("Couldn't open file.txtn"); return 1; } while(fgets(str, 1000, f)) { /* printf("%s", str); */ strcpy (string, "ls -la "); strcat (string, str); system (string); } fclose(f); return 0; }

modified on Thursday, February 19, 2009 8:56 PM

thanks Stuart for the information, I am a very new newbie and have no idea how that looks like in C, any chance of someone writing that in C ? apologizes for the inconvenience

Thanks very much Stuart! Any chance of typing the entire code in C as well? thanks a lot again!

Please please help with this simple Q from a C++ newbie....I spent hours trying to find the answer online... I want to run this on a linux box. Open a file containing a list of file names and then run a linux commands on each of the list for example: The file contains a list of files names eg: test test1 test2 test3 How do I code in C so that it opens the file and then foreach of the elements do a system command eg: ls in perl it would be something like: #!/usr/local/bin/perl while(<>){ chomp; $cmd="ls $_"; system($cmd); print "$cmd\n"; } Thanks in advance!

Please please help with this simple Q from a C newbie....I spent hours trying to find the answer online... I want to run this on a linux box. Open a file containing a list of file names and then run a linux commands on each of the list for example: The file contains a list of files names eg: test test1 test2 test3 How do I code in C so that it opens the file and then foreach of the elements do a system command eg: ls in perl it would be something like: #!/usr/local/bin/perl while(<>){ chomp; $cmd="ls $_"; system($cmd); print "$cmd\n"; } Thanks in advance!